SubtiBank SubtiBank
pspA [2018-02-13T15:03:47.000Z]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pspA [2018-02-13T15:03:47.000Z]

phage shock protein A homolog
24.99 kDa
protein length
227 aa Sequence Blast
gene length
681 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    671,245 → 671,928

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Protein family

  • pspA/IM30 family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|LiaH]
  • [SW|Localization]

  • membrane protein
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11454200], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696,20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by alkaline shock ([protein|search|SigW]) [Pubmed|11454200]
  • view in new tab

    Biological materials


  • MGNA-C430 (yqgI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06180 (Δ[gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGTTCCTCCTAA, downstream forward: _UP4_TAATACATAGGAGGCCGCAG
  • BKK06180 (Δ[gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGTTCCTCCTAA, downstream forward: _UP4_TAATACATAGGAGGCCGCAG
  • References

  • 11454200,18840696,22926563,23980836,27791134