SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to Ser/Thr kinase, increases the processivity of the [protein|C73E52D214E24F21696973B19B0A44CE785D6FBA|PcrA] helicase
43.72 kDa
protein length
410 aa Sequence Blast
gene length
1233 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    4,102,429 4,103,661

    The protein


  • [PDB|3HXJ] (from Methanococcus maripaludis, 33% Identity)
  • [SW|Localization]

  • extracellular (signal peptide), major constituent of the secretome [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860,15743949], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by [protein|search|Rok] [Pubmed|15743949]
  • view in new tab

    Biological materials


  • MGNA-B687 (yxaL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39940 ([gene|3BDC62A14BEEAEFD8E075E0958CAE41377808922|yxaL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTGAGACCCCCATTA, downstream forward: _UP4_TAACTGAATAGAATAGCAGA
  • BKK39940 ([gene|3BDC62A14BEEAEFD8E075E0958CAE41377808922|yxaL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTGAGACCCCCATTA, downstream forward: _UP4_TAACTGAATAGAATAGCAGA
  • Expression vectors

  • pGP392 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP824, available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • References

  • 12073041,10746760,15743949,18957862,31022189