SubtiBank SubtiBank
ytaF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ytaF

[SW|sporulation] protein
locus
BSU_29070
pI
9.79
mw
17.23 kDa
protein length
210 aa Sequence Blast
gene length
633 bp Sequence Blast
function
unknown
product
[SW|sporulation] protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,971,531 2,972,163

    Phenotypes of a mutant

  • strongly reduced [SW|sporulation] efficiency (10% as compared to wild type) [Pubmed|23396918]
  • block in stage III of [SW|sporulation] (engulfment of the forespore) [Pubmed|23396918]
  • The protein

    [SW|Domains]

  • 4 potential transmembrane domains [Pubmed|23396918]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA]-[gene|EC96EDED2472607DFA4C5EBA054157F7832EE41C|mutM]-[gene|3BEE8E248BC583FCCB37B7A209A122DD93CD398C|ytaF]-[gene|E163A282560DB882B81E783E7E95E1960F4AE4D2|ytaG]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|23396918], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A117 (ytaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/117 NBRP B. subtilis, Japan]
  • BKE29070 ([gene|3BEE8E248BC583FCCB37B7A209A122DD93CD398C|ytaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCGTTTCTTCCTTTC, downstream forward: _UP4_TAAAAAGGAGTGGATCTCTT
  • BKK29070 ([gene|3BEE8E248BC583FCCB37B7A209A122DD93CD398C|ytaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCGTTTCTTCCTTTC, downstream forward: _UP4_TAAAAAGGAGTGGATCTCTT
  • References

  • 23396918