SubtiBank SubtiBank
yvaO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvaO

similar to transcription regulator ([SW|Xre family])
locus
BSU_33670
pI
9.94
mw
15.43 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    3,457,104 3,457,523

    The protein

    Protein family

  • [SW|Xre family]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 8-63) (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A493 (yvaO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/493 NBRP B. subtilis, Japan]
  • BKE33670 ([gene|3C1F409135188353E2CD366FD03F5FE1679685AC|yvaO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTCTATCGCCTCACAT, downstream forward: _UP4_TAATCCCCTGTTTCTCTTTC
  • BKK33670 ([gene|3C1F409135188353E2CD366FD03F5FE1679685AC|yvaO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTCTATCGCCTCACAT, downstream forward: _UP4_TAATCCCCTGTTTCTCTTTC
  • References

  • 23504016