SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


riboflavin kinase with preference for dihydroriboflavin, binds FMN riboswitches of the rib operon and of ribU to allow expression even in the presence of FMN, required for the conversion of S-methyl-cysteine to cysteine
26.08 kDa
protein length
230 aa Sequence Blast
gene length
693 bp Sequence Blast
utilization of S-methyl-cysteine, regulation of rib operon expression
riboflavin kinase with preference for dihydroriboflavin

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|Conversion of S-methyl cysteine to cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    3,000,985 3,001,677

    Phenotypes of a mutant

  • no growth with S-methyl cysteine [Pubmed|23944997]
  • The protein

    Catalyzed reaction/ biological activity

  • synthesis of FMNH2 [Pubmed|26494285]
  • binds the [SW|FMN riboswitch] [Pubmed|26494285]
  • prevents transcription termination of the ''[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]'' operon even in the presence of FMN or FMNH2 [Pubmed|26494285]
  • prevents sequestration of the ribosome binding site of the ''[gene|651C370386E9FB45E3B98001800D342FEDB43E9A|ribU]'' mRNA even in the presence of FMN or FMNH2 [Pubmed|26494285]
  • ATP + riboflavin --> ADP + FMN + H+ (according to UniProt)
  • Protein family

  • RibR family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|85E732993186528CF58FECFFE89C8F39D278F28D|RibC]:
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials


  • MGNA-A154 (ribR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29300 ([gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAGTCAGCCTCCTCT, downstream forward: _UP4_GGATAGGGAAAGGAGCGGAA
  • BKK29300 ([gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAGTCAGCCTCCTCT, downstream forward: _UP4_GGATAGGGAAAGGAGCGGAA
  • References

  • 17590224,15668000,16109943,15272571,23944997,11390694,26494285