SubtiBank SubtiBank
yjzF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjzF

unknown
locus
BSU_11928
pI
11.75
mw
5.30 kDa
protein length
gene length
132 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,265,530 1,265,661

    Biological materials

    Mutant

  • BKE11928 (''[gene|3DA147AB1CDE38709E9180C3AD3257CE6572D7A8|yjzF]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1821 (''[gene|3DA147AB1CDE38709E9180C3AD3257CE6572D7A8|yjzF]''::''erm'', available in [SW|Jörg Stülke]'s lab)
  • BKE11928 ([gene|3DA147AB1CDE38709E9180C3AD3257CE6572D7A8|yjzF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11928 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTAATTACTCCTTTC, downstream forward: _UP4_AGAAAGTAAAAAGGGAGTTT
  • BKK11928 ([gene|3DA147AB1CDE38709E9180C3AD3257CE6572D7A8|yjzF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11928 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTAATTACTCCTTTC, downstream forward: _UP4_AGAAAGTAAAAAGGGAGTTT