SubtiBank SubtiBank
spoVFA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoVFA

dipicolinate synthase (subunit A)
locus
BSU_16730
pI
5.89
mw
31.80 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
dipicolic acid production
product
dipicolinate synthase (subunit A)
essential
no
synonyms
dpaA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.3|Biosynthesis of dipicolinate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,744,367 1,745,260

    The protein

    Catalyzed reaction/ biological activity

  • (S)-2,3-dihydrodipicolinate + NADP+ --> dipicolinate + H+ + NADPH (according to UniProt)
  • Structure

  • [PDB|2RIR]
  • Expression and Regulation

    Operons

    genes
    [gene|3DA80060554B78E9DC2189CECB78680095B08B32|spoVFA]-[gene|4D93A13DB9DC55A49525BFF4FD589F4FF67D50E8|spoVFB]-[gene|564A2F43F8AABE97FC8F0B1B3382A9F31F02FA18|asd]-[gene|6D6718AC72C9D86EDE16B191EDAB3ABA488B689B|dapG]-[gene|00B4CA4E25858A56F9D4E0ADEE2643F203FEC613|dapA]
    description
    [Pubmed|8098035]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,8098035], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,8098035]
  • view in new tab

    Biological materials

    Mutant

  • BKE16730 ([gene|3DA80060554B78E9DC2189CECB78680095B08B32|spoVFA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAACGTTCACCTTC, downstream forward: _UP4_CAAGCTGAGGAGGGGAAATA
  • BKK16730 ([gene|3DA80060554B78E9DC2189CECB78680095B08B32|spoVFA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAACGTTCACCTTC, downstream forward: _UP4_CAAGCTGAGGAGGGGAAATA
  • References

  • 8345520,8098035,15699190