SubtiBank SubtiBank
yhcW

yhcW

putative glycerol-3-phosphatase
locus
BSU_09240
pI
4.63
mw
24.53 kDa
protein length
220 aa Sequence Blast
gene length
663 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    997,724 998,386

    The protein

    Catalyzed reaction/ biological activity

  • glycerol-3-phosphate - glycerol + inorganic phosphate [Pubmed|22353596]
  • Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • CbbY/CbbZ/Gph/YieH family (with [protein|CAFAE305B1771DD89E81F75A6713161393BE99A0|PgcM], according to UniProt)
  • Paralogous protein(s)

  • [protein|CAFAE305B1771DD89E81F75A6713161393BE99A0|PgcM]:
  • Structure

  • [PDB|4UAR] (from ''Rhodobacter Sphaeroides'', 32% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|3DB9048B54C47E262997A2A5A0556AE607F93EA9|yhcW]-[gene|BDAA216E832B8EB267CED6456A0045254DD0E97D|yhcX]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A660 (yhcW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/660 NBRP B. subtilis, Japan]
  • BKE09240 ([gene|3DB9048B54C47E262997A2A5A0556AE607F93EA9|yhcW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGGGTACAACTCCTTTA, downstream forward: _UP4_CAAAACTAGAAAGGAGCGAG
  • BKK09240 ([gene|3DB9048B54C47E262997A2A5A0556AE607F93EA9|yhcW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGGGTACAACTCCTTTA, downstream forward: _UP4_CAAAACTAGAAAGGAGCGAG
  • References

  • 22353596,22383849