SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative glycerol-3-phosphatase
24.53 kDa
protein length
220 aa Sequence Blast
gene length
663 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    997,724 998,386

    The protein

    Catalyzed reaction/ biological activity

  • glycerol-3-phosphate - glycerol + inorganic phosphate [Pubmed|22353596]
  • Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • CbbY/CbbZ/Gph/YieH family (with [protein|CAFAE305B1771DD89E81F75A6713161393BE99A0|PgcM], according to UniProt)
  • Paralogous protein(s)

  • [protein|CAFAE305B1771DD89E81F75A6713161393BE99A0|PgcM]:
  • Structure

  • [PDB|4UAR] (from ''Rhodobacter Sphaeroides'', 32% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A660 (yhcW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09240 ([gene|3DB9048B54C47E262997A2A5A0556AE607F93EA9|yhcW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGGGTACAACTCCTTTA, downstream forward: _UP4_CAAAACTAGAAAGGAGCGAG
  • BKK09240 ([gene|3DB9048B54C47E262997A2A5A0556AE607F93EA9|yhcW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGGGTACAACTCCTTTA, downstream forward: _UP4_CAAAACTAGAAAGGAGCGAG
  • References

  • 22353596,22383849