SubtiBank SubtiBank
ytlC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ytlC

similar to anion transport [SW|ABC transporter] (ATP-binding protein)
locus
BSU_30610
pI
5.43
mw
29.15 kDa
protein length
260 aa Sequence Blast
gene length
783 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,133,387 3,134,169

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|675CE0BCA393E9C2795032F1C0FDE6AF08B77033|SsuB]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 4-231) (according to UniProt)
  • Structure

  • [PDB|1Z47] (ATP-binding subunit of sulfate [SW|ABC transporter] of Alicyclobacillus acidocaldarius, 39% identity) [pubmed|15893314]
  • Expression and Regulation

    Operons

    genes
    [gene|56E482D9CAC6E350140FD21A1C4AC8820B918CDA|ytlA]-[gene|3DC6A032B0F076A460FE2C3244D747CFC7583FE7|ytlC]-[gene|2768A088A2902FA776CB656F29A6F4B0C9E69CA7|ytlD]
    description
    [Pubmed|9387221]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A299 (ytlC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/299 NBRP B. subtilis, Japan]
  • BKE30610 ([gene|3DC6A032B0F076A460FE2C3244D747CFC7583FE7|ytlC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAGAAAGACATAGATGGCG, downstream forward: _UP4_ACGATATGGAAGGAGCTGAA
  • BKK30610 ([gene|3DC6A032B0F076A460FE2C3244D747CFC7583FE7|ytlC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAGAAAGACATAGATGGCG, downstream forward: _UP4_ACGATATGGAAGGAGCTGAA
  • References

  • 10092453,15699190,15383836,9387221,15893314