SubtiBank SubtiBank
yvbU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvbU

similar to transcriptional regulator ([SW|LysR family])
locus
BSU_33990
pI
5.63
mw
32.36 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|LysR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    3,487,974 3,488,852

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • Structure

  • [PDB|4GWO] (from Salmonella typhimurium, 25% identity)
  • Biological materials

    Mutant

  • MGNA-A466 (yvbU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/466 NBRP B. subtilis, Japan]
  • BKE33990 ([gene|3E32562E9E0F9547315C79D175E272FF53DC88FB|yvbU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAATTTACTTATGCT, downstream forward: _UP4_TAATGTTCCAAACCGTTCGT
  • BKK33990 ([gene|3E32562E9E0F9547315C79D175E272FF53DC88FB|yvbU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAATTTACTTATGCT, downstream forward: _UP4_TAATGTTCCAAACCGTTCGT