SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


scaffold of the germinosome, required for clustering of germinant receptors in the spore inner membrane
20.97 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    158,515 159,072

    Phenotypes of a mutant

  • defective in [SW|germination] in response to nutrients [Pubmed|24530795]
  • The protein

    Catalyzed reaction/ biological activity

  • required for clustering of germinant receptors in the spore inner membrane [Pubmed|21696470]
  • [SW|Domains]

  • has an N-terminal signal sequence and a signal for fixation to lipid [Pubmed|23335419]
  • Structure

  • [PDB|4O8W] [Pubmed|24530795]
  • [SW|Localization]

  • outer surface of the inner spore membrane [Pubmed|23335419,21696470]
  • inner spore membrane, spore coat, cortex, germ cell wall, some GerD is also present in the soluble fraction [Pubmed|19332816]
  • Additional information

  • 3,500 molecules are present per spore [Pubmed|23749970]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1906867,15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expression level depends on sporulation conditions (medim composition, temperature) [Pubmed|22327596]
  • additional information

  • 3,500 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials


  • 1A677 ( ''gerD''::''erm''), [Pubmed| ], available at [ BGSC]
  • 1G17 ( ''gerD''::''spec''), [Pubmed|15126458], available at [ BGSC]
  • BKE01550 ([gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTAAGCTCCTTTCAC, downstream forward: _UP4_TAAAGGGAAAGCCGGGATCT
  • BKK01550 ([gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTAAGCTCCTTTCAC, downstream forward: _UP4_TAAAGGGAAAGCCGGGATCT
  • Antibody

  • available in [SW|Anne Moir] lab
  • labs

  • [SW|Anne Moir], University of Sheffield, UK
  • References

  • 1906867,19332816,17122337,21725007,18556788,19332816,2517635,21696470,22327596,22493018,23335419,23749970,21398556,24530795,24752279,26731423