SubtiBank SubtiBank
yugF
The papers of the month are back! Check them out! Link here

yugF

similar to dihydrolipoamide S-acetyltransferase
locus
BSU31420
pI
8.36
mw
31.18 kDa
protein length
273 aa Sequence Blast
gene length
819 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,227,581 → 3,228,402

    The protein

    Protein family

  • dmpD/todF/xylF esterase family (according to Swiss-Prot)
  • Structure

  • [PDB|5JZ9] (26% identity) [pubmed|28380256]
  • Expression and Regulation

    Operons

    genes
    [gene|3EE40BA7FB4951A72964F847B6A678B48579D191|yugF]
    description
    [Pubmed|9274030]

    regulation

  • expressed during [category|SW 4.2|Sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B550 (yugF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1549 NBRP B. subtilis, Japan]
  • BKE31420 (Δ[gene|3EE40BA7FB4951A72964F847B6A678B48579D191|yugF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTGTCACTCCCTTT, downstream forward: _UP4_TAACAAAAAAACCGGTGCTG
  • BKK31420 (Δ[gene|3EE40BA7FB4951A72964F847B6A678B48579D191|yugF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTGTCACTCCCTTT, downstream forward: _UP4_TAACAAAAAAACCGGTGCTG
  • References

  • 9274030,28380256