SubtiBank SubtiBank
queG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

queG

epoxyqueuosine reductase
locus
BSU_08910
pI
7.35
mw
48.37 kDa
protein length
386 aa Sequence Blast
gene length
1161 bp Sequence Blast
function
synthesis of queuosine, tRNA modification
product
epoxyqueuosine reductase
essential
no
synonyms
ygaP,yhbA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    967,935 969,095

    The protein

    Catalyzed reaction/ biological activity

  • conversion of epoxyqueuosine to queuosine [Pubmed|21502530]
  • Protein family

  • QueG family (single member, according to UniProt)
  • [SW|Cofactors]

  • cobalamin
  • Fe-S cluster [Pubmed|21502530]
  • Structure

  • [PDB|5D08] [Pubmed|27638883]
  • Expression and Regulation

    Operons

    genes
    [gene|3F22BD8DB7BEC2701B960546AC683603DFCADCCE|queG]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A241 (yhbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/241 NBRP B. subtilis, Japan]
  • BKE08910 ([gene|3F22BD8DB7BEC2701B960546AC683603DFCADCCE|queG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTGCACAGCCTCCT, downstream forward: _UP4_TGACATACGTATAGAGCAGA
  • BKK08910 ([gene|3F22BD8DB7BEC2701B960546AC683603DFCADCCE|queG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTGCACAGCCTCCT, downstream forward: _UP4_TGACATACGTATAGAGCAGA
  • References

  • 26230193,21502530,27638883