SubtiBank SubtiBank
ylqH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylqH

similar to flagellar biosynthetic protein
locus
BSU_16080
pI
7.26
mw
10.47 kDa
protein length
gene length
282 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.3|Flagellar proteins/ based on similarity]
  • Gene

    Coordinates
    1,679,977 1,680,258

    The protein

    Structure

  • [PDB|3B0Z] (from Salmonella typhimurium, corresponds to aa 30 ... 109 of YlqH, 40% identity) [pubmed|23633590]
  • Expression and Regulation

    Operons

    genes
    [gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]-[gene|0D4A4A1B2FD9D0698D0A65010A8ABC84DA7386A2|ylqG]-[gene|3F271D9FFE4F30D845319CD71662695AA592EC8F|ylqH]
    description
    [Pubmed|26577401]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    genes
    [gene|54CD247926F7FABE4ACE85EB7021B62500B47260|rbgA]-[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]-[gene|0D4A4A1B2FD9D0698D0A65010A8ABC84DA7386A2|ylqG]-[gene|3F271D9FFE4F30D845319CD71662695AA592EC8F|ylqH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B175 (ylqH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1174 NBRP B. subtilis, Japan]
  • 1A828 ( ''ylqH''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A828&Search=1A828 BGSC]
  • BKE16080 ([gene|3F271D9FFE4F30D845319CD71662695AA592EC8F|ylqH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCTGATCGGTGTCTGCT, downstream forward: _UP4_TAGCTAAAATATTCCCCATC
  • BKK16080 ([gene|3F271D9FFE4F30D845319CD71662695AA592EC8F|ylqH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCTGATCGGTGTCTGCT, downstream forward: _UP4_TAGCTAAAATATTCCCCATC
  • References

  • 26577401,23633590