SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glutamate 5-kinase
40.20 kDa
protein length
371 aa Sequence Blast
gene length
1116 bp Sequence Blast
osmoadaptive de novo production of proline
glutamate 5-kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of proline]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    2,015,733 2,016,848

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-glutamate --> ADP + L-glutamyl 5-phosphate (according to UniProt)
  • Protein family

  • glutamate 5-kinase family (with [protein|5592C5163CF024289B850916516E2C8C7AD43136|ProB], according to UniProt)
  • Paralogous protein(s)

  • [protein|5592C5163CF024289B850916516E2C8C7AD43136|ProB]
  • [SW|Domains]

  • PUA domain (aa 280-356) (according to UniProt)
  • Structure

  • [PDB|4Q1T] (from ''Burkholderia thailandensis'', 39% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21784929], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • expressed under conditions of osmotic stress [Pubmed|21784929]
  • view in new tab

    Biological materials


  • GP817 (spc) available in [SW|Jörg Stülke]'s lab
  • 1A635 ( ''proJ''::''erm''), [Pubmed|3015878], available at [ BGSC]
  • BKE18470 ([gene|3F47513FB71276EF1E99B8C427DC8DC0786F8C19|proJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTTTTCATGCTTGTATCAG, downstream forward: _UP4_TAATTTGCAGAAAAAAACCC
  • BKK18470 ([gene|3F47513FB71276EF1E99B8C427DC8DC0786F8C19|proJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTTTTCATGCTTGTATCAG, downstream forward: _UP4_TAATTTGCAGAAAAAAACCC
  • References


  • 25367752
  • Original publications

  • 21296969,25344233,21784929,27766092,28752945