SubtiBank SubtiBank
opuBA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

opuBA

choline and arsenocholine [SW|ABC transporter] (ATP-binding protein)
locus
BSU_33730
pI
5.65
mw
42.92 kDa
protein length
381 aa Sequence Blast
gene length
1146 bp Sequence Blast
function
compatible solute transport
product
choline and arsenocholine [SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms
proV

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.4|Uptake of compatible solutes for osmoprotection]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,462,105 3,463,250

    The protein

    Catalyzed reaction/ biological activity

  • uptake of choline and arsenocholine [pubmed|29159878]
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|434F6C546F783503A82D390FD238F05025FC1802|MsmX], [protein|75DB6231129C28C5D3791BA43A1261CD46A861E8|OpuCA], [protein|FB2220730013A98D7C979062A4A451518B92DF09|OpuAA]
  • [SW|Domains]

  • 2 [SW|CBS domain]s (aa 256-314, aa 316-374) (according to UniProt)
  • [SW|ABC transporter domain] (aa 2-236) (according to UniProt)
  • Structure

  • [PDB|2IT1] (from Pyrococcus horikoshii, 43% identity)
  • [SW|Localization]

  • associated to the membrane (via [protein|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|OpuBB]-[protein|1532EC3D741C5AB3D0B642741218FAE00AD460FA|OpuBD]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD]
    description
    [Pubmed|10216873]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10216873], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR]: repression, (transcriptional roadblock) [Pubmed|32849357,22408163], in [regulon|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR regulon]
  • [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR]: repression, (sterical interference with RNA polymerase access) [Pubmed|32849357,23960087], in [regulon|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • regulation

  • induced by choline ([protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR]) [Pubmed|22408163]
  • expression increases with increasing salinity [Pubmed|32849357]
  • additional information

  • [gene|6FCF6F71C5A8B2345F42BD0C3345C520FD40358B|S1290] acts as [SW|ncRNA|antisense RNA] for the [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD] operon [PubMed|,32373088,20525796]
  • expression starts with a delay after osmotic upshift due to transcriptional interference of [SW|RNA polymerase] complexes driving synthesis of the converging opuB and [gene|6FCF6F71C5A8B2345F42BD0C3345C520FD40358B|S1290] mRNAs [pubmed|32373088]
  • view in new tab

    Biological materials

    Mutant

  • BKE33730 ([gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACATCGCACCTCCAAAA, downstream forward: _UP4_TAGGGAGGGGCGATAAGTCA
  • BKK33730 ([gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACATCGCACCTCCAAAA, downstream forward: _UP4_TAGGGAGGGGCGATAAGTCA
  • Expression vectors

  • pGP2938: (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP3013: (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 27935846
  • Original publications

  • 10092453,9925583,10216873,21296969,23960087,22408163,23646920,29159878,32373088,32849357