SubtiBank SubtiBank
nasB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

nasB

nitrate reductase (electron transfer subunit)
locus
BSU_03320
pI
5.48
mw
84.57 kDa
protein length
771 aa Sequence Blast
gene length
2316 bp Sequence Blast
function
utilization of nitrate
product
nitrate reductase (electron transfer subunit)
essential
no
synonyms
nasBA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.1|Utilization of nitrate/ nitrite]
  • Gene

    Coordinates
    360,442 362,757

    The protein

    Paralogous protein(s)

  • [protein|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|NasD]
  • [SW|Cofactors]

  • FAD [Pubmed|11289299]
  • Structure

  • [PDB|3KLJ] (from Clostridium acetobutylicum, corresponds to aa 2 ... 371, 27% identity) [pubmed|20017214]
  • Expression and Regulation

    Operons

    genes
    [gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]-[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]-[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
    description
    [Pubmed|7836289]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7836289], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [PubMed|8799114,9765565], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials

    Mutant

  • 1A971 ( ''nasB''::''erm''), [Pubmed|7868621], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A971&Search=1A971 BGSC]
  • BKE03320 ([gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATCAGACCTCCTTTG, downstream forward: _UP4_TGAGGCATTTTGACTGAACG
  • BKK03320 ([gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATCAGACCTCCTTTG, downstream forward: _UP4_TGAGGCATTTTGACTGAACG
  • References

    Reviews

  • 22103536,11289299
  • Original publications

  • 7836289,12823818,7868621,25755103,8799114,16885456,20017214