SubtiBank SubtiBank
sdpI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sdpI

immunity protein, protection against SdpC
locus
BSU_33780
pI
9.61
mw
23.15 kDa
protein length
207 aa Sequence Blast
gene length
624 bp Sequence Blast
function
protection against SdpC
product
immunity protein
essential
no
synonyms
yvaZ

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,466,434 3,467,057

    The protein

    Paralogous protein(s)

  • [protein|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|YfhL], [protein|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|YbgB]
  • Effectors of protein activity

  • in the presence of extracellular [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC], [protein|3FB5839A7A80CF52E627FF1744E50490F5CC390F|SdpI] binds and sequesters [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR] , this results in induction of the ''[gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]'' operon [Pubmed|16469701]
  • [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]
    description
    [Pubmed|12817086]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16469701], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|16469701], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR]: repression, [Pubmed|16469701], in [regulon|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR regulon]
  • regulation

  • induced by extracellular [protein|search|SdpC] ([protein|search|SdpR]) [Pubmed|16469701]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A454 (yvaZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/454 NBRP B. subtilis, Japan]
  • BKE33780 ([gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTATGGAAATTATATTTT, downstream forward: _UP4_TGAAAAAGTGTCTTGCGGAG
  • BKK33780 ([gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTATGGAAATTATATTTT, downstream forward: _UP4_TGAAAAAGTGTCTTGCGGAG
  • References

    Reviews

  • 20955377
  • Original Publications

  • 12817086,16469701,20563570