SubtiBank SubtiBank
ctc
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ctc

general stress protein, similar to ribosomal protein L25
locus
BSU_00520
pI
4.22
mw
21.91 kDa
protein length
204 aa Sequence Blast
gene length
615 bp Sequence Blast
function
[SW|translation] (under stress conditions)
product
ribosomal protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    58,783 59,397

    The protein

    Protein family

  • Bacterial ribosomal protein bL25 family (single member, according to UniProt)
  • Structure

  • [PDB|1FEU] (from ''Thermus thermophilus'', 32% identity, 53% similarity) [Pubmed|11418764]
  • [SW|Localization]

  • in the ribosome (large subunit) [Pubmed|12432960]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|23540C0D84F55135E39A09F48E48AB6F7C270B2E|gcaD]-[gene|37664AAEBFFDE1F7D17EA7C032805EA051FBE6AF|prs]-[gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|8522540], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • view in new tab

    genes
    [gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]-[gene|FE7859E98F26E532AE02CD71B42B845BADBCF06E|spoVC]-[gene|C595D32D98723E93AF26B5C864FD61AF4739E069|fin]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced under stress conditions ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [pubmed|15805528]
  • view in new tab

    genes
    [gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced under stress conditions ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B912 (ctc::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1911 NBRP B. subtilis, Japan]
  • GP500(spc), available in [SW|Jörg Stülke]'s lab [Pubmed|12432960]
  • CS206 (''[gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE00520 ([gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCAGCACCATCCTCT, downstream forward: _UP4_TAATAGCTTAAGGCGTAACC
  • BKK00520 ([gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCAGCACCATCCTCT, downstream forward: _UP4_TAATAGCTTAAGGCGTAACC
  • Expression vectors

  • expression/ purification with N-terminal His-tag in ''E. coli'': pGP804 (in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab [Pubmed|12432960]
  • Antibody

  • available in [SW|Jörg Stülke]'s lab [Pubmed|12432960]
  • References

    Reviews

  • 19216708
  • Original publications

  • 2836704,3123466,3100810,8522540,15805528,12432960,6790515,2836704,116131,11418764,23002217,27197833