SubtiBank SubtiBank
yddN

yddN

similar to alkanal monooxygenase
locus
BSU_05040
pI
5.19
mw
37.88 kDa
protein length
339 aa Sequence Blast
gene length
1020 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    550,240 551,259

    The protein

    Paralogous protein(s)

  • [protein|A36E7D50E2EBD0F0109491FF2CAD2CA84372B2CF|YvbT]
  • [protein|1432F56AD3D2B2BD82D8759CE4DC42C0D40C49C0|YceB]:
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|4US5] (from ''Streptomyces bottropensis'', 30% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|40654E556CC97A4E47FC757F93F29BEACD21CC3A|yddN]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C124 (yddN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2122 NBRP B. subtilis, Japan]
  • BKE05040 ([gene|40654E556CC97A4E47FC757F93F29BEACD21CC3A|yddN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCACCTCTAAAAT, downstream forward: _UP4_TAGAAATCGAGTCAGTTGTA
  • BKK05040 ([gene|40654E556CC97A4E47FC757F93F29BEACD21CC3A|yddN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCACCTCTAAAAT, downstream forward: _UP4_TAGAAATCGAGTCAGTTGTA