SubtiBank SubtiBank
yddN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yddN

similar to alkanal monooxygenase
locus
BSU_05040
pI
5.19
mw
37.88 kDa
protein length
339 aa Sequence Blast
gene length
1020 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    550,240 551,259

    The protein

    Paralogous protein(s)

  • [protein|A36E7D50E2EBD0F0109491FF2CAD2CA84372B2CF|YvbT]
  • [protein|1432F56AD3D2B2BD82D8759CE4DC42C0D40C49C0|YceB]:
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|4US5] (from ''Streptomyces bottropensis'', 30% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|40654E556CC97A4E47FC757F93F29BEACD21CC3A|yddN]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C124 (yddN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2122 NBRP B. subtilis, Japan]
  • BKE05040 ([gene|40654E556CC97A4E47FC757F93F29BEACD21CC3A|yddN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCACCTCTAAAAT, downstream forward: _UP4_TAGAAATCGAGTCAGTTGTA
  • BKK05040 ([gene|40654E556CC97A4E47FC757F93F29BEACD21CC3A|yddN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCACCTCTAAAAT, downstream forward: _UP4_TAGAAATCGAGTCAGTTGTA