SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


polyketide synthase
475.31 kDa
protein length
4262 aa Sequence Blast
gene length
12789 bp Sequence Blast
polyketide synthesis
polyketide synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    1,821,553 1,834,341

    The protein


  • 4 [SW|Carrier domain]s (aa 293-367, aa 2188-2261, aa 3409-3486, aa 4135-4212) (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|24187085], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|24187085], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed during the transition from growth to stationary phase ([protein|search|AbrB], [protein|search|CodY]) [Pubmed|24187085]
  • additional information

  • this is a very large operon comprising about 75 kb
  • view in new tab

    view in new tab

    Biological materials


  • BKE17200 ([gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTATCATTTTCCCACTCC, downstream forward: _UP4_TAAAGAAATTCTCGATGCCT
  • BKK17200 ([gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTATCATTTTCCCACTCC, downstream forward: _UP4_TAAAGAAATTCTCGATGCCT
  • References

  • 17190806,22383849,24187085