SubtiBank SubtiBank
yteR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yteR

galacturonyl hydrolase, catalyses intracellular degradation of disaccharides generated by [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX]
locus
BSU_30120
pI
5.87
mw
42.81 kDa
protein length
370 aa Sequence Blast
gene length
1113 bp Sequence Blast
function
intracellular degradation of disaccharides generated by [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX]
product
galacturonyl hydrolase, catalyses intracellular degradation of disaccharides generated by [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • Gene

    Coordinates
    3,081,131 3,082,243

    The protein

    Protein family

  • glycosyl hydrolase 105 family (with [protein|8EED04FCE6E2900B729178209FB281F5463B2540|RhiN], according to UniProt)
  • Structure

  • [PDB|2GH4], [PDB|2D8L] (complex with D-GlcA-Gal-nc)
  • Expression and Regulation

    Operons

    genes
    [gene|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|yteP]-[gene|40787292458E5C6676F9F4F6F34C0D6BD5313DE1|yteR]-[gene|1482FD92CB6DC966263F08AD109769728FC708E4|yteS]-[gene|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT]-[gene|103A912E971E5760DBA45CC0681D77CED61D1FED|yteU]-[gene|FCAE9513D764B7A9AAB9C59E6CE1D65C400D4B44|yteV]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • MGNA-A811 (yteR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/811 NBRP B. subtilis, Japan]
  • BKE30120 ([gene|40787292458E5C6676F9F4F6F34C0D6BD5313DE1|yteR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATCCATTGATCCCATCC, downstream forward: _UP4_CCTCTTTTTAGGTCAGCGGG
  • BKK30120 ([gene|40787292458E5C6676F9F4F6F34C0D6BD5313DE1|yteR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATCCATTGATCCCATCC, downstream forward: _UP4_CCTCTTTTTAGGTCAGCGGG
  • References

  • 12884008,16870154,16781735,17449691