SubtiBank SubtiBank
degR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

degR

regulation of degradative enzyme production
locus
BSU_21940
pI
5.16
mw
6.97 kDa
protein length
gene length
183 bp Sequence Blast
function
control of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] activity
product
positive effector of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-phosphate stability
essential
no
synonyms
prtR

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • Gene

    Coordinates
    2,308,157 2,308,339

    The protein

    [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|40BAECB64BAF8ED6C343E484663573A36415E675|degR]
    description
    [Pubmed|3082853]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8550420], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE21940 ([gene|40BAECB64BAF8ED6C343E484663573A36415E675|degR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTGCGTTCCCCTTCT, downstream forward: _UP4_TAGGAGAGGCGAATGCCTCT
  • BKK21940 ([gene|40BAECB64BAF8ED6C343E484663573A36415E675|degR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTGCGTTCCCCTTCT, downstream forward: _UP4_TAGGAGAGGCGAATGCCTCT
  • References

  • 9335269,1459944,9108277,3098734,8550420,3082853