SubtiBank SubtiBank
fabHA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fabHA

beta-ketoacyl-acyl carrier protein synthase III, principal condensing enzyme responsible for the initiation of fatty acid synthesis in non-stressed B. subtilis cells
locus
BSU_11330
pI
5.05
mw
33.58 kDa
protein length
312 aa Sequence Blast
gene length
939 bp Sequence Blast
function
fatty acid biosynthesis
product
beta-ketoacyl-acyl carrier protein synthase III
essential
no
ec
2.3.1.180
synonyms
yjaX

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.1|Biosynthesis of fatty acids]
  • Gene

    Coordinates
    1,208,222 1,209,160

    Phenotypes of a mutant

  • significant increase in the proportion of straight-chain fatty acids with a concomitant increase in 31:0-carbon phosphatidylethanolamine species [Pubmed|21542858]
  • The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + H+ + malonyl-[ACP] --> 3-oxobutanoyl-[ACP] + CO2 + CoA (according to UniProt)
  • Protein family

  • [SW|thiolase-like superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|FC818B3A8A3080231C1F8DE95377325C8E754DCE|FabHB]:
  • Structure

  • [PDB|1EBL] (FabH from ''E. coli'') [Pubmed|10673437]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • affinity for butyryl-CoA, but prefers acetyl-CoA in fatty acid biosynthesis [Pubmed|19820084]
  • Expression and Regulation

    Operons

    genes
    [gene|40E064365588CFED483FBFED02BFC0DA531CCC4A|fabHA]-[gene|5D5D9A544295DD9B55C75A8CF47AB19935E740C6|fabF]
    description
    [Pubmed|12737802]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12737802], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|21542858], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]: repression, [Pubmed|12737802], in [regulon|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR regulon]
  • regulation

  • ''[SW|fabHA]'': expressed when the cells experience a lack of malonyl-CoA ([protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]) [Pubmed|12737802]
  • expression of the operon is strongly reduced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B145 (yjaX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1144 NBRP B. subtilis, Japan]
  • BKE11330 ([gene|40E064365588CFED483FBFED02BFC0DA531CCC4A|fabHA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGGGAAGACTCCTTTA, downstream forward: _UP4_TAAAAAAAGGTGAGGTGCAC
  • BKK11330 ([gene|40E064365588CFED483FBFED02BFC0DA531CCC4A|fabHA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGGGAAGACTCCTTTA, downstream forward: _UP4_TAAAAAAAGGTGAGGTGCAC
  • References

    Reviews

  • 15952903,17919287
  • Original Publications

  • 12737802,17114254,10629181,10673437,19820084,21383089,21542858,25196128,30925337,31113899