SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


UDP-2,4,6-trideoxy-2-acetamido-4-amino glucose acetyltransferase, extracellular polysaccharide synthesis
22.34 kDa
protein length
216 aa Sequence Blast
gene length
651 bp Sequence Blast
[category|SW 4.1.2|Biofilm formation], biosynthesis of N,N'-diacetylbacillosamine
UDP-2,4,6-trideoxy-2-acetamido-4-amino glucose acetyltransferase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Matrix polysaccharide synthesis]
  • Gene

    3,516,233 3,516,883

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]
  • The protein

    Catalyzed reaction/ biological activity

  • conversion of UDP-2,4,6-trideoxy-2-acetamido-4-amino glucose to UDP-2,4,6-trideoxy-2,4-diacetamido glucose (N,N'-diacetylbacillosamine) [pubmed|30314705]
  • Protein family

  • [SW|Transferase hexapeptide repeat family] (according to UniProt)
  • [SW|Cofactors]

  • coenzyme A [pubmed|30314705]
  • Structure

  • [PDB|4M99] (from Neisseria gonorrhoeae, 38% identity) [pubmed|24064219]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
  • view in new tab

    Biological materials


  • MGNA-B609 (yvfD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34240 ([gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCACCCACAATGGCCACAT, downstream forward: _UP4_CAAACATCAAACAAAGGATG
  • BKK34240 ([gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCACCCACAATGGCCACAT, downstream forward: _UP4_CAAACATCAAACAAAGGATG
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]
  • References


  • 20735481
  • Research papers

  • 30222950,30314705,24064219
  • The EAR [SW|RNA switch]

  • 20374491,20230605