SubtiBank SubtiBank
frlR
The papers of the month are back! Check them out! Link here

frlR

transcriptional regulator (GntR family)
locus
BSU32560
pI
6.42
mw
27.36 kDa
protein length
242 aa Sequence Blast
gene length
726 bp Sequence Blast
function
regulation of utilization of sugar amines
product
transcriptional regulator (GntR family)
essential
no
synonyms
yurK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.17|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.3|Utilization of amino sugars]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,346,298 → 3,347,026

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • Structure

  • [PDB|2IKK] (C-terminal domain)
  • Biological materials

    Mutant

  • MGNA-A557 (yurK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/557 NBRP B. subtilis, Japan]
  • BKE32560 (Δ[gene|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTAGCCTCCTTTTA, downstream forward: _UP4_TAACAGGCATAAAAAACGAG
  • BKK32560 (Δ[gene|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTAGCCTCCTTTTA, downstream forward: _UP4_TAACAGGCATAAAAAACGAG
  • References

  • 21347729,21398478