SubtiBank SubtiBank
frlR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

frlR

transcriptional regulator ([SW|GntR family])
locus
BSU_32560
pI
6.42
mw
27.36 kDa
protein length
242 aa Sequence Blast
gene length
729 bp Sequence Blast
function
regulation of utilization of sugar amines
product
transcriptional regulator ([SW|GntR family])
essential
no
synonyms
yurK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.17|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.3|Utilization of amino sugars]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,346,298 3,347,026

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • Structure

  • [PDB|2IKK] (C-terminal domain)
  • Biological materials

    Mutant

  • MGNA-A557 (yurK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/557 NBRP B. subtilis, Japan]
  • BKE32560 ([gene|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTAGCCTCCTTTTA, downstream forward: _UP4_TAACAGGCATAAAAAACGAG
  • BKK32560 ([gene|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTAGCCTCCTTTTA, downstream forward: _UP4_TAACAGGCATAAAAAACGAG
  • References

  • 21347729,21398478