SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional regulator ([SW|GntR family])
27.36 kDa
protein length
242 aa Sequence Blast
gene length
729 bp Sequence Blast
regulation of utilization of sugar amines
transcriptional regulator ([SW|GntR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    3,346,298 3,347,026

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • [SW|Domains]

  • [SW|HTH gntR-type domain] (aa 8-76) (according to UniProt)
  • Structure

  • [PDB|2IKK] (C-terminal domain)
  • Biological materials


  • MGNA-A557 (yurK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32560 ([gene|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTAGCCTCCTTTTA, downstream forward: _UP4_TAACAGGCATAAAAAACGAG
  • BKK32560 ([gene|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTAGCCTCCTTTTA, downstream forward: _UP4_TAACAGGCATAAAAAACGAG
  • References

  • 21347729,21398478