SubtiBank SubtiBank
yxkD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yxkD

unknown
locus
BSU_38840
pI
8.61
mw
30.58 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,987,927 3,988,763

    The protein

    Protein family

  • [SW|UPF0750 membrane proteins] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|417714CA91427D583ED87E4804DE399D53A51C71|yxkD]
    description
    [Pubmed|10746760]

    regulation

  • induced in the presence of guanidine ([SW|ykkC riboswitch]) [Pubmed|27989440]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yxkD'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B738 (yxkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1737 NBRP B. subtilis, Japan]
  • BKE38840 ([gene|417714CA91427D583ED87E4804DE399D53A51C71|yxkD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGAAAACACTCCTTT, downstream forward: _UP4_TAAAGAAAAATCCCTCTGTA
  • BKK38840 ([gene|417714CA91427D583ED87E4804DE399D53A51C71|yxkD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGAAAACACTCCTTT, downstream forward: _UP4_TAAAGAAAAATCCCTCTGTA
  • References

    Reviews

  • 28060483
  • Original publications

  • 15096624,10746760,21317561,27120414,27989440