SubtiBank SubtiBank


bifunctional homocysteine S-methyltransferase/5,10-methylenetetrahydrofolate reductase
67.75 kDa
protein length
612 aa Sequence Blast
gene length
1839 bp Sequence Blast
methionine biosynthesis, tetrahydrofolate interconversion
bifunctional homocysteine S-methyltransferase/5,10-methylenetetrahydrofolate reductase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,178,757 1,180,595

    The protein

    Catalyzed reaction/ biological activity

  • S-methyl-L-methionine + L-homocysteine --> 2 L-methionine (according to UniProt)
  • 5-methyltetrahydrofolate + NAD(P)+ --> 5,10-methylenetetrahydrofolate + NAD(P)H (according to UniProt)
  • Protein family

  • C-terminal part: methylenetetrahydrofolate reductase family (single member, according to UniProt)
  • [SW|Domains]

  • Hcy-binding domain (aa 1-280) (according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Zn2+ (according to UniProt)
  • Structure

  • [PDB|1Q7M] (the methionine synthase domain, from Thermotoga maritima, 31% identity) [pubmed|14752199]
  • [PDB|6FNU] (the methylene THF reductase domain, from Saccharomyces cerevisiae, 25% identity)
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation




  • [Pubmed|10094622]
  • regulatory mechanism

  • [regulon|S-box|S-box]: termination/antitermination, [pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B195 (yitJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11010 ([gene|41AB43191DDB2E0698D92FFD1ECEF45100F1F3F0|yitJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTGCCTCCTTTATT, downstream forward: _UP4_TAATTTCCAAAAGACTGCCT
  • BKK11010 ([gene|41AB43191DDB2E0698D92FFD1ECEF45100F1F3F0|yitJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTGCCTCCTTTATT, downstream forward: _UP4_TAATTTCCAAAAGACTGCCT
  • References

    The [protein|search|S-box]

  • 19258532,10094622,18039762,20951706,22543867,29604896,29794222
  • Other publications

  • 19779461,12107147,18763711,22960854,14752199