SubtiBank SubtiBank
lcfB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

lcfB

long-chain fatty-acid-CoA ligase, involved in surfactin production
locus
BSU_10270
pI
5.30
mw
56.41 kDa
protein length
513 aa Sequence Blast
gene length
1542 bp Sequence Blast
function
fatty acid degradation
product
long-chain fatty-acid-CoA ligase
essential
no
ec
6.2.1.3
synonyms
yhfL

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.3|Utilization of fatty acids]
  • Gene

    Coordinates
    1,100,980 1,102,521

    The protein

    Catalyzed reaction/ biological activity

  • long-chain fatty acid + ATP + CoA --> long-chain fatty acyl-CoA + AMP + diphosphate (according to UniProt)
  • activates 3-hydroxy fatty acids for surfactin biosynthesis [Pubmed|20797616]
  • Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5050649605DD782AF10FC0AEEA5F14036EC0197D|YhfT], [protein|5F73ACDEAFC7F1EB26D55195100C3283FC1F587C|YngI], [protein|7AC5217CA35F8E134ABB35D74F1BA5E684D2E058|LcfA]
  • Structure

  • [PDB|3R44] (Very-long-chain fatty acyl-CoA synthetase from Mycobacterium tuberculosis, 35% identity) [pubmed|22560731]
  • Expression and Regulation

    Operons

    genes
    [gene|41B879EF69E2D4F5C1896A4709567B88FD8AC5B7|lcfB]
    description
    [Pubmed|17189250]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17189250], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced in the presence of long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B277 (yhfL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1276 NBRP B. subtilis, Japan]
  • available in [SW|Mohamed Marahiel]'s lab [Pubmed|20797616]
  • BKE10270 ([gene|41B879EF69E2D4F5C1896A4709567B88FD8AC5B7|lcfB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCCACCCCTTAAGT, downstream forward: _UP4_TAAAATGAAAAAGCGAAGCG
  • BKK10270 ([gene|41B879EF69E2D4F5C1896A4709567B88FD8AC5B7|lcfB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCCACCCCTTAAGT, downstream forward: _UP4_TAAAATGAAAAAGCGAAGCG
  • References

  • 17189250,17919287,20797616,22560731