SubtiBank SubtiBank
yqfC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqfC

sporulation protein
locus
BSU_25360
pI
8.97
mw
10.65 kDa
protein length
gene length
282 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,616,667 2,616,948

    Expression and Regulation

    Operons

    genes
    [gene|41CC88CC3AE4FDDA909CCEF2DED16B554341D81E|yqfC]-[gene|E5F5528DA775DE3EE2DD1EC931CDC7E3781E018C|yqfD]
    description
    [Pubmed|12662922]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|12662922,15383836]
  • view in new tab

    Biological materials

    Mutant

  • BKE25360 ([gene|41CC88CC3AE4FDDA909CCEF2DED16B554341D81E|yqfC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAGAACCCCCTT, downstream forward: _UP4_TCATAAAGCCGAGGGGGAAA
  • BKK25360 ([gene|41CC88CC3AE4FDDA909CCEF2DED16B554341D81E|yqfC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAGAACCCCCTT, downstream forward: _UP4_TCATAAAGCCGAGGGGGAAA
  • References

  • 12662922,15383836