SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


44.70 kDa
protein length
409 aa Sequence Blast
gene length
1227 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    403,217 → 404,443

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • expressed at high cell density ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051]
  • additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials


  • MGNA-C002 (ycxA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03530 (Δ[gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCGACCTGCCTTTA, downstream forward: _UP4_TCAATATAAAAGGATCAGCA
  • BKK03530 (Δ[gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCGACCTGCCTTTA, downstream forward: _UP4_TCAATATAAAAGGATCAGCA
  • References

  • 16091051