SubtiBank SubtiBank
ywoB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ywoB

unknown
locus
BSU_36500
pI
10.11
mw
17.29 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,756,044 3,756,508

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|42FD1230682897172C3D4EA09980E566835EEF34|ywoB]-[gene|ECBA7A0C8E705A464ACF627EBAFF7482EAEE34F2|ywoC]-[gene|856247843F1073833D51F82AB2928CCDC0DA3E64|ywoD]
    description
    [Pubmed|21856850]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21856850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA]: repression, [Pubmed|21856850], in [regulon|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA regulon]
  • regulation

  • induced by ramoplanin ([protein|search|YtrA]) [Pubmed|21856850]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A944 (ywoB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/944 NBRP B. subtilis, Japan]
  • BKE36500 ([gene|42FD1230682897172C3D4EA09980E566835EEF34|ywoB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATCCCCCTCAGTGTA, downstream forward: _UP4_TGACGCCCTTTATGATTACA
  • BKK36500 ([gene|42FD1230682897172C3D4EA09980E566835EEF34|ywoB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATCCCCCTCAGTGTA, downstream forward: _UP4_TGACGCCCTTTATGATTACA