SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


phosphate [SW|ABC transporter] (ATP-binding protein)
29.85 kDa
protein length
269 aa Sequence Blast
gene length
810 bp Sequence Blast
high-affinity phosphate uptake
phosphate [SW|ABC transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,578,003 2,578,812

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + phosphate --> ADP + H+ + 2 phosphate (according to UniProt)
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|GlnQ], [protein|6882EF93EC82872B25C88104F62D6603D2514890|ArtR], [protein|B24763A732111026D21C828FF9BE73FB22A123CF|TcyN], [protein|B453986691E1231A1C565D469A2A60EBFF2F6BD3|TcyC], [protein|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|YxeO], [protein|0D5BC94E21D51373A50D61CE3D0895B3DB28F6B3|PstBB]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 23-264) (according to UniProt)
  • Structure

  • [PDB|2OLJ] (from Geobacillus stearothermophilus, 37% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9098050], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]-P, [PubMed|9098050,9593301], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation (5000-fold induced) ([protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]) [,9593301 PubMed]
  • additional information

  • mRNA processing between [gene|BA45631351E3C9C140D15F620D7B7AC143C04932|pstS] and [gene|8BC7CCE9EBD899912ED7C72CA04FE82B21516F77|pstC] to maintain higher concentrations of [protein|BA45631351E3C9C140D15F620D7B7AC143C04932|PstS] relative to other components of the [SW|ABC transporter] [PubMed|15289558]
  • view in new tab

    Biological materials


  • MGNA-C440 (yqgJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24960 ([gene|434BCED6953BE07D592AC229264C5AD0D04CBAF6|pstBA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTCGCCTCTTTCC, downstream forward: _UP4_GGGAAATTCGGATAGGAGGG
  • BKK24960 ([gene|434BCED6953BE07D592AC229264C5AD0D04CBAF6|pstBA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTCGCCTCTTTCC, downstream forward: _UP4_GGGAAATTCGGATAGGAGGG
  • labs

  • [SW|Marion Hulett], University of Illinois at Chicago, USA [ Homepage]
  • References

  • 15289558,10092453,12897025,10913081,9098050,9098050,9593301