SubtiBank SubtiBank
msmX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

msmX

multiple sugar [SW|ABC transporter ](ATP-binding protein)
locus
BSU_38810
pI
7.39
mw
41.21 kDa
protein length
365 aa Sequence Blast
gene length
1098 bp Sequence Blast
function
uptake of maltodextrin, melibiose (probably), and galactooligosaccharides
product
multiple sugar [SW|ABC transporter ](ATP-binding protein)
essential
no
synonyms
yxkG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.21|Utilization of melibiose]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.24|Utilization of galactan]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,984,133 3,985,230

    Phenotypes of a mutant

  • no growth with pectin or galactan as single carbon source [pubmed|29240795]
  • The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|YurJ], [protein|3F502A4DCB1DAD7C3F968465B13C35213240515B|OpuBA]
  • Structure

  • [PDB|1G29] (from Thermococcus litoralis, 54% identity) [pubmed|11080142]
  • [SW|Localization]

  • cell membrane (via [protein|8AF43CA410F3381209196E1B9A4FE66D78020793|AraP]-[protein|AE532A8931D516CC676E765D1D1293E73C335D23|AraQ]) and [protein|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|MdxF]-[protein|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|MdxG] [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|9EE268C3DC3C0F2F846DAEB2004222B6F841B9EA|yxkF]-[gene|434F6C546F783503A82D390FD238F05025FC1802|msmX]
    description
    [Pubmed|10746760]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B741 (msmX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1740 NBRP B. subtilis, Japan]
  • BKE38810 ([gene|434F6C546F783503A82D390FD238F05025FC1802|msmX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAACATCCCCCTTTGT, downstream forward: _UP4_TAAGATCAAAAAAACCGGAC
  • BKK38810 ([gene|434F6C546F783503A82D390FD238F05025FC1802|msmX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAACATCCCCCTTTGT, downstream forward: _UP4_TAAGATCAAAAAAACCGGAC
  • References

  • 10092453,16672620,10746760,16707683,10666464,22900538,27501980,29240795,11080142,31138628