SubtiBank SubtiBank
mprF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mprF

synthesis of lysylphosphatidylglycerol (L-PG), lysinylation of phosphatidylglycerol provides some resistance against positively charged antimicrobial peptides
locus
BSU_08425
pI
9.00
mw
96.00 kDa
protein length
856 aa Sequence Blast
gene length
2571 bp Sequence Blast
function
lysyl-phosphatidylglycerol lipid biosynthesis
product
lysyl-phosphatidylglycerol synthase
essential
no
synonyms
yfiW,yfiX

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    916,778 919,348

    Phenotypes of a mutant

  • reduced conjugation of ICEBs1 [Pubmed|25069588,26833415]
  • overexpression results in increased conjugation of ICEBs1 [Pubmed|26833415]
  • The protein

    Catalyzed reaction/ biological activity

  • 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) + L-lysyl-tRNALys --> 1,2-diacyl-sn-glycero-3-phospho-1ʼ-(3ʼ-O-L-lysyl)-sn-glycerol + tRNALys (according to UniProt)
  • Protein family

  • LPG synthase family (single member, according to UniProt)
  • Structure

  • [PDB|4V36] (Lys-tRNA(Lys)-dependent lysyl-phosphatidylglycerol synthase domain from ''B. licheniformis'', 76% identity) [Pubmed|26261323]
  • [SW|Localization]

  • cell membrane at the septum [Pubmed|15743965]
  • Expression and Regulation

    Operons

    genes
    [gene|4385EA135BDEB54B33C9A8E39150A60C83C0CEEA|mprF]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C310 (yfiX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2308 NBRP B. subtilis, Japan]
  • GP2246 (''[gene|4385EA135BDEB54B33C9A8E39150A60C83C0CEEA|mprF]''::''ermC''), available in [SW|Jörg Stülke]'s lab
  • BKE08425 ([gene|4385EA135BDEB54B33C9A8E39150A60C83C0CEEA|mprF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08425 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTCTCTCCAATCATA, downstream forward: _UP4_GTCTAATAAGACGGAGTCTT
  • BKK08425 ([gene|4385EA135BDEB54B33C9A8E39150A60C83C0CEEA|mprF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08425 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTCTCTCCAATCATA, downstream forward: _UP4_GTCTAATAAGACGGAGTCTT
  • References

  • 19164152,18820022,19734140,18305156,12427923,15743965,25069588,26261323,26833415