SubtiBank SubtiBank
yxlH
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yxlH

similar to multidrug-efflux transporter
locus
BSU_38640
pI
9.02
mw
43.80 kDa
protein length
400 aa Sequence Blast
gene length
1203 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,966,745 3,967,947

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|TCR/Tet family] (according to UniProt)
  • Structure

  • [PDB|3WDO] (26% identity) [pubmed|23950222]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|43917869D4E75015CEA23109E8F97DFFECD39C14|yxlH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B754 (yxlH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1753 NBRP B. subtilis, Japan]
  • BKE38640 ([gene|43917869D4E75015CEA23109E8F97DFFECD39C14|yxlH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTATCTCTCCACCCCT, downstream forward: _UP4_GCGCAAAAACGTAACATGAT
  • BKK38640 ([gene|43917869D4E75015CEA23109E8F97DFFECD39C14|yxlH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTATCTCTCCACCCCT, downstream forward: _UP4_GCGCAAAAACGTAACATGAT
  • References

    Research papers

  • 23950222