SubtiBank SubtiBank
zwf [2019-07-04 14:05:49]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

zwf [2019-07-04 14:05:49]

glucose 6-phosphate dehydrogenase, pentose-phosphate pathway
55.49 kDa
protein length
489 aa Sequence Blast
gene length
1470 bp Sequence Blast
initiation of the pentose phosphate pathway
glucose 6-phosphate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Pentose phosphate pathway]
  • Gene

    2,479,156 2,480,625

    Phenotypes of a mutant

  • suppresses the growth defect of [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutants on gluconeogenic substrates [Pubmed|16272399]
  • The protein

    Catalyzed reaction/ biological activity

  • D-glucose 6-phosphate + NADP+ = D-glucono-1,5-lactone 6-phosphate + NADPH (according to Swiss-Prot)
  • Protein family

  • glucose-6-phosphate dehydrogenase family (according to Swiss-Prot)
  • [SW|Cofactors]

  • Mg2+, Mn2+, Ca2+
  • Effectors of protein activity

  • NAD+, NADP+ and NADPH affect the enzyme kinetic [Pubmed|6292660]
  • Structure

  • [PDB|1DPG] (from ''Leuconostoc Mesenteroides'', 45% identity, 62% similarity) [Pubmed|7881907]
  • Additional information

  • The enzyme is a dimer [Pubmed|6292660]
  • Expression and Regulation




  • constitutive [Pubmed|12850135]
  • view in new tab

    Biological materials


  • MGNA-C392 (yqjJ::erm), available at the [ NBRP B. subtilis, Japan]
  • SM-NB3 (''zwf-spc''), available in [SW|Anne Galinier]'s and [SW|Boris Görke]'s labs [pubmed|16272399]
  • BKE23850 ([gene|43CD2581DA421CABC66E30389640CC86E6B2D800|zwf]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAAAAGTACCTCACTTT, downstream forward: _UP4_TAATAAGAAGAAAAAAGCCG
  • BKK23850 ([gene|43CD2581DA421CABC66E30389640CC86E6B2D800|zwf]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAAAAGTACCTCACTTT, downstream forward: _UP4_TAATAAGAAGAAAAAAGCCG
  • FLAG-tag construct

  • GP1401 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 6292660,12850135,19779711,7881907,24571712,16272399