SubtiBank SubtiBank
ykpC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ykpC

unknown
locus
BSU_14460
pI
12.19
mw
4.37 kDa
protein length
gene length
135 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,516,339 1,516,473

    Expression and Regulation

    Operons

    genes
    [gene|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH]-[gene|440E24C24D7B12175A839D7DC310339DF75BCB09|ykpC]
    description
    [Pubmed|27965289]

    sigma factors

  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [Pubmed|18156261], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|24125693], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • expression is increased in an [gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP] mutant [Pubmed|22362028]
  • induced at high temperature ([protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI], [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]) [Pubmed|24125693,18156261]
  • view in new tab

    Biological materials

    Mutant

  • BKE14460 ([gene|440E24C24D7B12175A839D7DC310339DF75BCB09|ykpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTCCTCCTTAACG, downstream forward: _UP4_TAATATTGAAAAAACCCAAG
  • BKK14460 ([gene|440E24C24D7B12175A839D7DC310339DF75BCB09|ykpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTCCTCCTTAACG, downstream forward: _UP4_TAATATTGAAAAAACCCAAG
  • References

  • 24125693,18156261,22362028,27965289,29914988