SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


phosphoribosylaminoimidazole succinocarboxamide synthase
27.31 kDa
protein length
241 aa Sequence Blast
gene length
726 bp Sequence Blast
purine biosynthesis
phosphoribosylaminoimidazole succinocarboxamide synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    701,601 702,326

    The protein

    Catalyzed reaction/ biological activity

  • 5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate + ATP + L-aspartate --> (2S)-2-[5-amino-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamido]succinate + ADP + 2 H+ + phosphate (according to UniProt)
  • Protein family

  • SAICAR synthetase family (according to Swiss-Prot)
  • Structure

  • [PDB|1KUT] (from ''Thermotoga maritima'', 40% identity, 57% similarity) [Pubmed|16582479]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • BKE06450 ([gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGAAGGCCTCCTAACCC, downstream forward: _UP4_TTCAATAGACTGGGAGGCAT
  • BKK06450 ([gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGAAGGCCTCCTAACCC, downstream forward: _UP4_TTCAATAGACTGGGAGGCAT
  • References

  • 12884008,3036807,12923093,7638212,15378759