SubtiBank SubtiBank
yqhR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqhR

unknown
locus
BSU_24480
pI
5.88
mw
20.02 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,540,288 2,540,824

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|449EEBF33F52B461F244331ACD140E68CF64EE7C|yqhR]-[gene|D7503C73C0BC2E411C651E409E91C2E22E8842E5|yqhS]-[gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]-[gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C438 (yqhR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2436 NBRP B. subtilis, Japan]
  • BKE24480 ([gene|449EEBF33F52B461F244331ACD140E68CF64EE7C|yqhR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCACCTCCAGTTAAAG, downstream forward: _UP4_TAGTGTATAATCCTTTTCCA
  • BKK24480 ([gene|449EEBF33F52B461F244331ACD140E68CF64EE7C|yqhR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCACCTCCAGTTAAAG, downstream forward: _UP4_TAGTGTATAATCCTTTTCCA