SubtiBank SubtiBank
rplA
The papers of the month are back! Check them out! Link here

rplA

ribosomal protein
locus
BSU01030
pI
9.73
mw
24.77 kDa
protein length
232 aa Sequence Blast
gene length
696 bp Sequence Blast
function
translation
product
ribosomal protein L1 (BL1)
essential
no
synonyms

Genomic Context

      

Gene

Coordinates
119,111 → 119,809

Phenotypes of a mutant

  • slow growth, this can be suppressed by inactivation of [gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|yhdP] [pubmed|29967120]
  • reduced sporulation frequency, this can be suppressed by inactivation of [gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|yhdP] [pubmed|29967120]
  • The protein

    Protein family

  • ribosomal protein L1P family (according to Swiss-Prot)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Expression and Regulation

    Operons

    genes
    [gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]-[gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA]-[gene|E4D89640D0F0A31A2814D20FB5425FDB0B46A43D|BSU_misc_RNA_3]-[gene|5EF3A7953AA97D2B44C967542A53FEA7F36D7BA3|rplJ]-[gene|E72910604D3DC2A62AE8A951F55570EA2838B250|rplL]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials

    Mutant

  • BKE01030 (Δ[gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAAATTTCCTCCTT, downstream forward: _UP4_TAATATTGACATGACATCAA
  • BKK01030 (Δ[gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAAATTTCCTCCTT, downstream forward: _UP4_TAATATTGACATGACATCAA
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1094 (erm, based on [SW|pGP1087]), available in [SW|Jörg Stülke]'s lab
  • References

  • 17981968,19653700,11463749,22848659,23175651,23002217,25903689,29967120