SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ribosomal protein
24.77 kDa
protein length
232 aa Sequence Blast
gene length
699 bp Sequence Blast
ribosomal protein L1 (BL1)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosomal proteins]
  • Gene

    119,111 119,809

    Phenotypes of a mutant

  • slow growth, this can be suppressed by inactivation of [gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA] [pubmed|29967120]
  • reduced sporulation frequency, this can be suppressed by inactivation of [gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA] [pubmed|29967120]
  • The protein

    Protein family

  • universal [SW|ribosomal protein] uL1 family (single member, according to UniProt)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • [SW|Localization]

  • [SW|ribosome] (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials


  • BKE01030 ([gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAAATTTCCTCCTT, downstream forward: _UP4_TAATATTGACATGACATCAA
  • BKK01030 ([gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAAATTTCCTCCTT, downstream forward: _UP4_TAATATTGACATGACATCAA
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1094 (erm, based on [SW|pGP1087]), available in [SW|Jörg Stülke]'s lab
  • References

  • 17981968,19653700,11463749,22848659,23175651,23002217,25903689,29967120