SubtiBank SubtiBank
gltA
The papers of the month are back! Check them out! Link here

gltA

large subunit of glutamate synthase
locus
BSU18450
pI
5.47
mw
168.61 kDa
protein length
1520 aa Sequence Blast
gene length
4560 bp Sequence Blast
function
glutamate biosynthesis
product
glutamate synthase (large subunit)
essential
no
ec
1.4.1.13
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,010,070 → 2,014,632

    Phenotypes of a mutant

  • auxotrophic for glutamate
  • The protein

    Catalyzed reaction/ biological activity

  • 2 L-glutamate + NADP+ --> L-glutamine + 2-oxoglutarate + NADPH (according to Swiss-Prot)
  • Protein family

  • glutamate synthase family (according to Swiss-Prot) glutamate synthase family
  • Paralogous protein(s)

  • [protein|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|YerD]
  • [SW|Domains]

  • Glutamine amidotransferase type-2 domain (22-415)
  • Nucleotide binding domain (1060-1112)
  • Modification

  • phosphorylated on Arg-904 AND/OR Arg-914 [Pubmed|22517742]
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • FAD, FMN
  • Structure

  • [PDB|2VDC] (the [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|GltA]-[protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|GltB] complex of ''Azospirillum brasiliense'') [Pubmed|18199747]
  • [SW|Localization]

  • membrane associated [pubmed|18763711], cytoplasm (according to UniProt)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • [SW|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [Pubmed|23239624,23239623]
  • Expression and Regulation

    Operons

    genes
    [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]
    description
    [Pubmed|12823818]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2548995], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|11029411], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]: activation, [Pubmed|2548995], in [regulon|87BCAE725B02860156D50E1783F6DB68510C811E|GltC regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: indirect effect, in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • expressed in the presence of ammonium [Pubmed|11029411]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation inhibition, [Pubmed|22389480]
  • Biological materials

    Mutant

  • GP807 (del ''[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]''::''tet'') , available in [SW|Jörg Stülke]'s lab
  • GP222 (''gltA'' under the control of p-xyl), available in [SW|Jörg Stülke]'s lab
  • 1A808 ( ''gltA''::''cat''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A808&Search=1A808 BGSC]
  • 1A809 ( ''gltA''::''kan''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A809&Search=1A809 BGSC]
  • BKE18450 (Δ[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCTCTCCCCCGAT, downstream forward: _UP4_GTACAGTAAGGAAGGGGAGA
  • BKK18450 (Δ[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCTCTCCCCCGAT, downstream forward: _UP4_GTACAGTAAGGAAGGGGAGA
  • lacZ fusion

  • pGP526 (in [protein|search|pAC7]), available in [SW|Jörg Stülke]'s lab [pubmed|14523131]
  • pGP919 (in [protein|search|pAC5]), available in [SW|Jörg Stülke]'s lab [pubmed|17183217]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Labs working on this gene/protein

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • [SW|Jörg Stülke], University of Göttingen, Germany
  • [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • [SW|Fabian Commichau] University of Göttingen, Germany
  • [http://genmibio.uni-goettingen.de/index.php?id=130 Homepage]
  • References

    Reviews

  • 16143852,12859215,22625175,12859215
  • Original publications

  • 12823818,18199747,11029411,12850135,7559360,15150225,2548995,17183217,17608797,17134717,14523131,12823818,18326565,17981983,18763711,20933603,17012385,22389480,22517742,25755103,28294562,28386026,29242163