SubtiBank SubtiBank
ytsJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytsJ

malic enzyme, forms a transhydrogenation cycle with [protein|search|MalS ]for balancing of NADPH
locus
BSU29220
pI
5.05
mw
43.51 kDa
protein length
410 aa Sequence Blast
gene length
1230 bp Sequence Blast
function
malate utilization
product
NADP-dependent malate dehydrogenase
essential
no
ec
1.1.1.38
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • Gene

    Coordinates
    2,989,900 → 2,991,132

    Phenotypes of a mutant

  • Poor growth with malate as single carbon source [Pubmed|16788182]
  • The protein

    Catalyzed reaction/ biological activity

  • (S)-malate + NADP+ = pyruvate + CO2 + NADPH (according to Swiss-Prot) malate <-→ pyruvate
  • Protein family

  • malic enzymes family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|BBBCD5F56779895189E21076AF165B901F654534|MalS], [protein|160EBB7885D7C7FD30A6E35605A862C156E2DA80|MleA]
  • [SW|Cofactors]

  • NADP+
  • Structure

  • [PDB|1WW8] (from ''Pyrococcus horikoshii'', 46% identity, 63% similarity)
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]
    description
    [Pubmed|9387221]
    view in new tab

    genes
    [gene|65B5EA4DBDF5B260DED754B8A7B226AA88F17B55|dnaE]-[gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [PubMed|14593098,16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14593098,16267290 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A176 (ytsJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/176 NBRP B. subtilis, Japan]
  • GP612 (spc), available in [SW|Jörg Stülke]'s lab
  • GP1143 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE29220 (Δ[gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTAAACACTCCTT, downstream forward: _UP4_TAATTTTAATTCATTCCAAA
  • BKK29220 (Δ[gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTAAACACTCCTT, downstream forward: _UP4_TAATTTTAATTCATTCCAAA
  • GFP fusion

  • GP1432 (spc, based on [SW|pGP1870]), available in the [SW|Stülke] lab
  • FLAG-tag construct

  • GP1131 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 16479537,16788182,12949160,9387221,23136871,22740702,15378759