SubtiBank SubtiBank
yciB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yciB

putative L,D-transpeptidase
locus
BSU_03350
pI
6.18
mw
21.94 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
function
unknown
product
putative L,D-transpeptidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    365,170 365,754

    The protein

    Protein family

  • YkuD family (with [protein|6F256986E591DB82974A7F54EB1CE0C024A6F63B|Ldt] and [protein|293794B65B9EEB7F049138F73893303BABFB9A2A|YqjB], according to UniProt)
  • Structure

  • [PDB|4LZH] (from Klebsiella pneumoniae, 27% identity)
  • [SW|Localization]

  • lipoprotein, cell membrane at the cell poles [Pubmed|20013255]
  • Expression and Regulation

    Operons

    genes
    [gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]-[gene|456AF184261976FAA73359E81443F7035F457D07|yciB]-[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
    description
    [Pubmed|9811636]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12426338], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • [SW|folE2]: induced by zinc starvation ([protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]) [Pubmed|12426338]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B998 (yciB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1997 NBRP B. subtilis, Japan]
  • BKE03350 ([gene|456AF184261976FAA73359E81443F7035F457D07|yciB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCAATAATGAATAATGAGA, downstream forward: _UP4_TGAATTGAAAACCGTTGACA
  • BKK03350 ([gene|456AF184261976FAA73359E81443F7035F457D07|yciB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCAATAATGAATAATGAGA, downstream forward: _UP4_TGAATTGAAAACCGTTGACA
  • References

  • 12426338,20013255,9811636