SubtiBank SubtiBank
xpf
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

xpf

PBSX phage RNA polymerase sigma factor
locus
BSU_12560
pI
8.08
mw
19.95 kDa
protein length
169 aa Sequence Blast
gene length
510 bp Sequence Blast
function
transcription of PBSX prophage genes
product
PBSX prophage RNA polymerase sigma factor
essential
no
synonyms
pcf, ykxE

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    Coordinates
    1,324,471 1,324,980

    Biological materials

    Mutant

  • BKE12560 ([gene|458406A4E6824C24493CFC19718F10720AA3B453|xpf]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATGATCCTCCTCAT, downstream forward: _UP4_TGAAAGCTTGTCATACGTTT
  • BKK12560 ([gene|458406A4E6824C24493CFC19718F10720AA3B453|xpf]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATGATCCTCCTCAT, downstream forward: _UP4_TGAAAGCTTGTCATACGTTT
  • References

  • 8083174