SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


pyruvate dehydrogenase (E1 beta subunit)
35.32 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast
links glycolysis and TCA cycle
pyruvate dehydrogenase (E1 beta subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    1,529,445 1,530,422

    Phenotypes of a mutant

  • defects in sporulation and unable to grow on glucose as single carbon source [Pubmed|11976308]
  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • Pyruvate [dihydrolipoyllysine-residue acetyltransferase] lipoyllysine = [dihydrolipoyllysine-residue acetyltransferase] S-acetyldihydrolipoyllysine CO2 (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|AcoB], [protein|A024921961A786294199EA12E04456C890ED8D8C|BkdAB]
  • Kinetic information

  • Michaelis-Menten [Pubmed|6414463]
  • Modification

  • phosphorylation on (Ser-302 OR Ser-306) [Pubmed|17218307]
  • Effectors of protein activity

  • Inhibited thiamine 2-thiothiazolone diphosphate and NADH [Pubmed|6414463]
  • Low sensibility to NADPH
  • Structure

  • [PDB|1W88] (E1 in complex with subunit binding domain of E2, ''Geobacillus stearothermophilus'')
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20081037], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, due to presence of guanine at 1 position of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • regulation

  • ''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • GP459 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE14590 ([gene|458E967052D1093A0F48AE0E6B6CCA0F52EAC44D|pdhB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATTGTCATTTGCGCCA, downstream forward: _UP4_TAATCAAACTGCATAATCGA
  • BKK14590 ([gene|458E967052D1093A0F48AE0E6B6CCA0F52EAC44D|pdhB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCATTGTCATTTGCGCCA, downstream forward: _UP4_TAATCAAACTGCATAATCGA
  • lacZ fusion

  • pGP722 (in [SW|pAC5]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Arthur Aronson], Purdue University, West Lafayette, USA [ homepage]
  • References


  • 19476487,9655937,2227213,6805383,24798336
  • Original publications

  • 9352926,15378759,12850135,17218307,18763711,6414463,11976308,28189581