SubtiBank SubtiBank
psdA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

psdA

[SW|ABC transporter] (ATP-binding protein) for the export of lipid II-binding lantibiotics, such as nisin and gallidermin
locus
BSU_34700
pI
6.34
mw
28.89 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
function
export of toxic peptides
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms
yvcR

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.3|Export of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,565,496 3,566,275

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|YxdL], [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE], [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|BceA], [protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|YknY], [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 4-248) (according to UniProt)
  • Structure

  • [PDB|1L2T] (MJ0796 from '' Methanocaldococcus jannaschii '', 44% identity) [Pubmed|12150914]
  • [SW|Localization]

  • membrane associated (via [protein|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|PsdB]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|985E7F25C809AA5DF372101E64960DF704EED53F|psdR]-[gene|A9525886E911164BDFF0A55DA9F5FDD1C1B7A3B6|psdS]-[gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]-[gene|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|psdB]
    description
    [Pubmed|21078927]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21078927], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|985E7F25C809AA5DF372101E64960DF704EED53F|PsdR]: activation, [Pubmed|21078927], in [regulon|985E7F25C809AA5DF372101E64960DF704EED53F|PsdR regulon]
  • regulation

  • ''[protein|search|psdA]'': induced by nisin, gallidermin ([protein|search|PsdR]) [Pubmed|21078927]
  • view in new tab

    genes
    [gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]-[gene|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|psdB]
    description
    [Pubmed|18394148]

    regulation

  • ''[protein|search|psdA]'': induced by nisin, gallidermin ([protein|search|PsdR]) [Pubmed|21078927]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B635 (yvcR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1634 NBRP B. subtilis, Japan]
  • BKE34700 ([gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTGCTCCTCCTTTT, downstream forward: _UP4_TTGAGTGTGTTGGGAGGCGA
  • BKK34700 ([gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTGCTCCTCCTTTT, downstream forward: _UP4_TTGAGTGTGTTGGGAGGCGA
  • References

  • 18394148,10092453,21283517,26364265,12150914,27997719