SubtiBank SubtiBank
psdA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

psdA

ABC transporter (ATP-binding protein) for the export of lipid II-binding lantibiotics, such as nisin and gallidermin
locus
BSU34700
pI
6.34
mw
28.89 kDa
protein length
259 aa Sequence Blast
gene length
777 bp Sequence Blast
function
export of toxic peptides
product
ABC transporter (ATP-binding protein)
essential
no
synonyms
yvcR

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.3|Export of peptides]
  • Gene

    Coordinates
    3,565,496 → 3,566,275

    The protein

    Structure

  • [PDB|1L2T] (MJ0796 from '' Methanocaldococcus jannaschii '', 44% identity) [Pubmed|12150914]
  • [SW|Localization]

  • membrane associated (via [protein|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|PsdB]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|985E7F25C809AA5DF372101E64960DF704EED53F|psdR]-[gene|A9525886E911164BDFF0A55DA9F5FDD1C1B7A3B6|psdS]-[gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]-[gene|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|psdB]
    description
    [Pubmed|21078927]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21078927], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|985E7F25C809AA5DF372101E64960DF704EED53F|PsdR]: activation, [Pubmed|21078927], in [regulon|985E7F25C809AA5DF372101E64960DF704EED53F|PsdR regulon]
  • regulation

  • ''[protein|search|psdA]'': induced by nisin, gallidermin ([protein|search|PsdR]) [Pubmed|21078927]
  • view in new tab

    genes
    [gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]-[gene|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|psdB]
    description
    [Pubmed|18394148]

    regulation

  • ''[protein|search|psdA]'': induced by nisin, gallidermin ([protein|search|PsdR]) [Pubmed|21078927]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B635 (yvcR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1634 NBRP B. subtilis, Japan]
  • BKE34700 (Δ[gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]::erm trpC2), available at [http://www.bgsc.org/getdetail.php?bgscid=BSU34700 BGSC], upstream reverse: _UP1_CATGTTCTGCTCCTCCTTTT, downstream forward: _UP4_TTGAGTGTGTTGGGAGGCGA
  • BKK34700 (Δ[gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]::kan trpC2), available at [http://www.bgsc.org/getdetail.php?bgscid=BSU34700 BGSC], upstream reverse: _UP1_CATGTTCTGCTCCTCCTTTT, downstream forward: _UP4_TTGAGTGTGTTGGGAGGCGA
  • References

  • 18394148,10092453,21283517,26364265,12150914,27997719