SubtiBank SubtiBank
ytkC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ytkC

similar to autolytic amidase
locus
BSU_30640
pI
9.89
mw
15.01 kDa
protein length
134 aa Sequence Blast
gene length
405 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.2|Autolysis/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,135,668 3,136,072

    The protein

    Protein family

  • Cp-1 holin family (with [protein|F802500099D27794E836C84242BD6CEFB3E06EB7|YqxH], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4654294F23CBF2D66C72B05ADA9CDC002A30926A|ytkC]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A029 (ytkC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/29 NBRP B. subtilis, Japan]
  • BKE30640 ([gene|4654294F23CBF2D66C72B05ADA9CDC002A30926A|ytkC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCCCAACATCCTTT, downstream forward: _UP4_TAACTTTTCCCTGTTCGCGG
  • BKK30640 ([gene|4654294F23CBF2D66C72B05ADA9CDC002A30926A|ytkC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCCCAACATCCTTT, downstream forward: _UP4_TAACTTTTCCCTGTTCGCGG
  • References

  • 26577401