SubtiBank SubtiBank
ydzX
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydzX

unknown
locus
BSU_06319
pI
9.67
mw
11.00 kDa
protein length
gene length
288 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    686,602 686,889

    Biological materials

    Mutant

  • BKE06319 ([gene|46747F2F505AEB05F42E6F8E907599B01FEBD1B3|ydzX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06319 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTGTAGACCCACT, downstream forward: _UP4_TAATATTCAGTAATGATTGC
  • BKK06319 ([gene|46747F2F505AEB05F42E6F8E907599B01FEBD1B3|ydzX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06319 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTGTAGACCCACT, downstream forward: _UP4_TAATATTCAGTAATGATTGC