SubtiBank SubtiBank
qdoR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

qdoR

transcriptional regulator ([SW|TetR family]), control of [gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH] and [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]
locus
BSU_39990
pI
6.11
mw
20.87 kDa
protein length
191 aa Sequence Blast
gene length
576 bp Sequence Blast
function
control of quercetin utilization
product
transcriptional regulator
essential
no
synonyms
yxaF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    4,107,352 4,107,927

    The protein

    Protein family

  • [SW|TetR family]
  • Paralogous protein(s)

  • [protein|52D560AA02F0849CB24460A496021560063B2E12|LmrA]
  • [SW|Domains]

  • [SW|HTH tetR-type domain] (aa 5-65) (according to UniProt)
  • Effectors of protein activity

  • flavonoids such as quercetin act as molecular inducers and result in release from DNA targets [Pubmed|17483215,21737930]
  • Structure

  • [PDB|1SGM] [pubmed|16475182]
  • Expression and Regulation

    Operons

    genes
    [gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]
    description
    [Pubmed|10746760]

    regulatory mechanism

  • [protein|52D560AA02F0849CB24460A496021560063B2E12|LmrA]: repression, [Pubmed|15317768], in [regulon|52D560AA02F0849CB24460A496021560063B2E12|LmrA regulon]
  • [protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|QdoR]: repression, [Pubmed|17483215], in [regulon|47387014B5E89BF218BA94D8C2A570479B1EFD4E|QdoR regulon]
  • regulation

  • induced by flavonoids such as quercetin ([protein|search|QdoR], [protein|search|LmrA]) [Pubmed|17483215]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B683 (yxaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1682 NBRP B. subtilis, Japan]
  • BKE39990 ([gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACATTCCCTCCTA, downstream forward: _UP4_TAGCATTTTGTTATCCTTTC
  • BKK39990 ([gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACATTCCCTCCTA, downstream forward: _UP4_TAGCATTTTGTTATCCTTTC
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • References

    Reviews

  • 24006471,25209494
  • Original publications

  • 17483215,10746760,21737930,16475182