SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional regulator ([SW|TetR family]), control of [gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH] and [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]
20.87 kDa
protein length
191 aa Sequence Blast
gene length
576 bp Sequence Blast
control of quercetin utilization
transcriptional regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    4,107,352 4,107,927

    The protein

    Protein family

  • [SW|TetR family]
  • Paralogous protein(s)

  • [protein|52D560AA02F0849CB24460A496021560063B2E12|LmrA]
  • Effectors of protein activity

  • flavonoids such as quercetin act as molecular inducers and result in release from DNA targets [Pubmed|17483215,21737930]
  • Structure

  • [PDB|1SGM] [pubmed|16475182]
  • Expression and Regulation



    regulatory mechanism

  • [protein|52D560AA02F0849CB24460A496021560063B2E12|LmrA]: repression, [Pubmed|15317768], in [regulon|52D560AA02F0849CB24460A496021560063B2E12|LmrA regulon]
  • [protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|QdoR]: repression, [Pubmed|17483215], in [regulon|47387014B5E89BF218BA94D8C2A570479B1EFD4E|QdoR regulon]
  • regulation

  • induced by flavonoids such as quercetin ([protein|search|QdoR], [protein|search|LmrA]) [Pubmed|17483215]
  • view in new tab

    Biological materials


  • MGNA-B683 (yxaF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39990 ([gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACATTCCCTCCTA, downstream forward: _UP4_TAGCATTTTGTTATCCTTTC
  • BKK39990 ([gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACATTCCCTCCTA, downstream forward: _UP4_TAGCATTTTGTTATCCTTTC
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • References


  • 24006471,25209494
  • Original publications

  • 17483215,10746760,21737930,16475182